ID: 970225093_970225096

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 970225093 970225096
Species Human (GRCh38) Human (GRCh38)
Location 4:13849525-13849547 4:13849539-13849561
Sequence CCCCTGAGAAGTAAATGCAACTT ATGCAACTTAATAAGCAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!