ID: 970248866_970248869

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 970248866 970248869
Species Human (GRCh38) Human (GRCh38)
Location 4:14093225-14093247 4:14093239-14093261
Sequence CCAGCTTAGAAGTCGGGTGGAAG GGGTGGAAGAGGAAGCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 52} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!