ID: 970323640_970323646

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 970323640 970323646
Species Human (GRCh38) Human (GRCh38)
Location 4:14900506-14900528 4:14900535-14900557
Sequence CCTTTTCCAGTTCAGAAGTCAGC CCCTCAGGAGACAACATTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 222} {0: 1, 1: 0, 2: 5, 3: 13, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!