ID: 970333319_970333329

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 970333319 970333329
Species Human (GRCh38) Human (GRCh38)
Location 4:15004756-15004778 4:15004772-15004794
Sequence CCCGGACCCCCGACGCGGGGAGG GGGGAGGCGCGGCGAGGACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128} {0: 1, 1: 0, 2: 4, 3: 84, 4: 496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!