ID: 970333889_970333893

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 970333889 970333893
Species Human (GRCh38) Human (GRCh38)
Location 4:15011629-15011651 4:15011649-15011671
Sequence CCCTCTTCCCAAAAAAATAGGAG GAGTTTTCAGTTTAATGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 417} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!