ID: 970334155_970334161

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 970334155 970334161
Species Human (GRCh38) Human (GRCh38)
Location 4:15016193-15016215 4:15016229-15016251
Sequence CCTGTATCCCCCACGTATACATA GTGTATACACATATGTAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 364} {0: 1, 1: 0, 2: 0, 3: 23, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!