ID: 970399100_970399106

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 970399100 970399106
Species Human (GRCh38) Human (GRCh38)
Location 4:15700884-15700906 4:15700904-15700926
Sequence CCAGGGATGCCCCAAAATTACTA CTAAACTAAAGGGAAAAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75} {0: 2, 1: 8, 2: 13, 3: 46, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!