ID: 970413953_970413956

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 970413953 970413956
Species Human (GRCh38) Human (GRCh38)
Location 4:15838118-15838140 4:15838144-15838166
Sequence CCATGTGATGCTCAATGGATCCC GTAAAATCTTTGACAAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 87} {0: 1, 1: 1, 2: 2, 3: 24, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!