ID: 970422526_970422541

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 970422526 970422541
Species Human (GRCh38) Human (GRCh38)
Location 4:15918841-15918863 4:15918883-15918905
Sequence CCCCTTCCCATCACTGTGCCTAA GGGGACCACTGGAGGAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!