ID: 970429609_970429618

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 970429609 970429618
Species Human (GRCh38) Human (GRCh38)
Location 4:15976794-15976816 4:15976836-15976858
Sequence CCGTGGAGTTGTGCCTTCTAGAT GCCTCCAGCTGGGGGCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128} {0: 1, 1: 1, 2: 6, 3: 57, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!