ID: 970486699_970486703

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 970486699 970486703
Species Human (GRCh38) Human (GRCh38)
Location 4:16531887-16531909 4:16531912-16531934
Sequence CCATAGTTTTTCCATGGATGCTT CAGTTCAAACAGATGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 205} {0: 1, 1: 0, 2: 1, 3: 28, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!