ID: 970503164_970503169

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 970503164 970503169
Species Human (GRCh38) Human (GRCh38)
Location 4:16699363-16699385 4:16699411-16699433
Sequence CCTGCTACAGACTTCATTCCCTG TCTTTCCGGTTCATGGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 157} {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!