|
Left Crispr |
Right Crispr |
Crispr ID |
970504369 |
970504372 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:16712183-16712205
|
4:16712218-16712240
|
Sequence |
CCAGAATATATAAAGAACTCTAA |
AGGCAACTCAATTTACAAATGGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 271, 2: 1256, 3: 6355, 4: 21889} |
{0: 1, 1: 3, 2: 20, 3: 164, 4: 681} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|