ID: 970504369_970504372

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 970504369 970504372
Species Human (GRCh38) Human (GRCh38)
Location 4:16712183-16712205 4:16712218-16712240
Sequence CCAGAATATATAAAGAACTCTAA AGGCAACTCAATTTACAAATGGG
Strand - +
Off-target summary {0: 5, 1: 271, 2: 1256, 3: 6355, 4: 21889} {0: 1, 1: 3, 2: 20, 3: 164, 4: 681}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!