ID: 970589988_970589992

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 970589988 970589992
Species Human (GRCh38) Human (GRCh38)
Location 4:17551327-17551349 4:17551366-17551388
Sequence CCAGAGAGTTGGAGGTTGCAGTG CTGCACTCCACCATGGTGACAGG
Strand - +
Off-target summary {0: 29, 1: 2394, 2: 41356, 3: 115627, 4: 212166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!