ID: 970593015_970593019

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 970593015 970593019
Species Human (GRCh38) Human (GRCh38)
Location 4:17576064-17576086 4:17576084-17576106
Sequence CCTCTCCAAAACCCTTAAAAACC ACCTTGACCCCAAATTCCTCAGG
Strand - +
Off-target summary {0: 17, 1: 51, 2: 82, 3: 85, 4: 377} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!