ID: 970593017_970593023

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 970593017 970593023
Species Human (GRCh38) Human (GRCh38)
Location 4:17576075-17576097 4:17576091-17576113
Sequence CCCTTAAAAACCTTGACCCCAAA CCCCAAATTCCTCAGGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 268} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!