ID: 970608003_970608006

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 970608003 970608006
Species Human (GRCh38) Human (GRCh38)
Location 4:17699743-17699765 4:17699759-17699781
Sequence CCAAAGGAATGAAGACTGCAGAA TGCAGAAATGGCAAACAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 305} {0: 1, 1: 0, 2: 0, 3: 24, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!