ID: 970615029_970615032

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 970615029 970615032
Species Human (GRCh38) Human (GRCh38)
Location 4:17760960-17760982 4:17760979-17761001
Sequence CCCAACAGTTGATTTGCACAGTC AGTCCCCTCCCCACTAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110} {0: 1, 1: 0, 2: 1, 3: 20, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!