ID: 970624097_970624100

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 970624097 970624100
Species Human (GRCh38) Human (GRCh38)
Location 4:17858394-17858416 4:17858422-17858444
Sequence CCAGAAGGAGAGGAGAGAGGAGA AGAAATACATTTAAAGAAATTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 26, 3: 196, 4: 1143} {0: 1, 1: 0, 2: 3, 3: 153, 4: 1374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!