ID: 970632071_970632074

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 970632071 970632074
Species Human (GRCh38) Human (GRCh38)
Location 4:17958215-17958237 4:17958232-17958254
Sequence CCATCAAGAAGGTCCTTCAGGAA CAGGAAAAAAACAGAATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 238} {0: 1, 1: 0, 2: 5, 3: 77, 4: 856}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!