ID: 970637104_970637112

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 970637104 970637112
Species Human (GRCh38) Human (GRCh38)
Location 4:18021668-18021690 4:18021692-18021714
Sequence CCGAGGGCTCCGGCACTGAGCGG GGCGGCGGCGGCGGCAGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 119} {0: 16, 1: 219, 2: 1452, 3: 2172, 4: 4103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!