ID: 970647723_970647732

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 970647723 970647732
Species Human (GRCh38) Human (GRCh38)
Location 4:18142006-18142028 4:18142058-18142080
Sequence CCCAGGTTCAAACTGCAGTTCAT TAGGGAGCACTGAAGGAGGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!