ID: 970735776_970735780

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 970735776 970735780
Species Human (GRCh38) Human (GRCh38)
Location 4:19165815-19165837 4:19165863-19165885
Sequence CCTGAAGACAAAAGCAAGCCAAC AGGAAAGCAGACAAATCAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 47, 4: 643}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!