ID: 970735777_970735781

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 970735777 970735781
Species Human (GRCh38) Human (GRCh38)
Location 4:19165833-19165855 4:19165870-19165892
Sequence CCAACAAAACCGTAAGAAAGACA CAGACAAATCAGAAGGAGTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!