ID: 970743585_970743588

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 970743585 970743588
Species Human (GRCh38) Human (GRCh38)
Location 4:19267166-19267188 4:19267209-19267231
Sequence CCTTTTTTCCTGAGGTAAAGCAG GCACACATACTTACACACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 24, 3: 268, 4: 2664}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!