ID: 970882776_970882785

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 970882776 970882785
Species Human (GRCh38) Human (GRCh38)
Location 4:20951135-20951157 4:20951164-20951186
Sequence CCCTGCCCCACCTATACATGCAT GAGATCATGTGAGGACACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 295} {0: 1, 1: 2, 2: 11, 3: 73, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!