ID: 970926068_970926071

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 970926068 970926071
Species Human (GRCh38) Human (GRCh38)
Location 4:21453787-21453809 4:21453803-21453825
Sequence CCATCTCCTTTCAGCTAGCACAT AGCACATTTTCTCTTTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 259} {0: 1, 1: 0, 2: 2, 3: 39, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!