ID: 970931270_970931277

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 970931270 970931277
Species Human (GRCh38) Human (GRCh38)
Location 4:21515154-21515176 4:21515179-21515201
Sequence CCTAGAGATTTCCATATGCCCCT ACTAGGCTGGAGCTCAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 212} {0: 1, 1: 1, 2: 6, 3: 63, 4: 863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!