ID: 970934892_970934893

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 970934892 970934893
Species Human (GRCh38) Human (GRCh38)
Location 4:21557824-21557846 4:21557839-21557861
Sequence CCTGGGCTTTGTAACTATAGAAA TATAGAAAAACAACTTACGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175} {0: 1, 1: 0, 2: 1, 3: 41, 4: 558}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!