ID: 970934892_970934895

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 970934892 970934895
Species Human (GRCh38) Human (GRCh38)
Location 4:21557824-21557846 4:21557849-21557871
Sequence CCTGGGCTTTGTAACTATAGAAA CAACTTACGAAGGAAGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175} {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!