ID: 970960140_970960146

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 970960140 970960146
Species Human (GRCh38) Human (GRCh38)
Location 4:21861964-21861986 4:21861992-21862014
Sequence CCCTCCTCCAAGCCTCCTTAAAC GCTGCTCCTTCACTACAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 266} {0: 1, 1: 0, 2: 2, 3: 60, 4: 1266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!