ID: 970975570_970975573

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 970975570 970975573
Species Human (GRCh38) Human (GRCh38)
Location 4:22039455-22039477 4:22039478-22039500
Sequence CCACACCTGGCCGAAAATTCTTT TCTTTAAGAGCGTTGAATATTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 97, 3: 591, 4: 2924} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!