ID: 970993204_970993214

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 970993204 970993214
Species Human (GRCh38) Human (GRCh38)
Location 4:22236593-22236615 4:22236643-22236665
Sequence CCTCCTACTTCAGTCTGCTAAGT CTGGCTTCACCTGGTTTTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 80, 3: 1236, 4: 11733} {0: 1, 1: 0, 2: 1, 3: 14, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!