ID: 971083532_971083541

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 971083532 971083541
Species Human (GRCh38) Human (GRCh38)
Location 4:23243872-23243894 4:23243913-23243935
Sequence CCTTTTCTCTCCAGCCACCACCA TCTGGGGCCAAGAAGCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 69, 4: 712} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!