ID: 971158622_971158627

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 971158622 971158627
Species Human (GRCh38) Human (GRCh38)
Location 4:24109845-24109867 4:24109885-24109907
Sequence CCTTTGCTTCCTTAGAAGTGGTG TGTCCTCCAGCTACTGCAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 20, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!