ID: 971180275_971180278

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 971180275 971180278
Species Human (GRCh38) Human (GRCh38)
Location 4:24323767-24323789 4:24323794-24323816
Sequence CCATCCTCCTGCTCTTTGCTCTG AAAGATCCACCTACGACCTCAGG
Strand - +
Off-target summary {0: 10, 1: 34, 2: 50, 3: 113, 4: 938} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!