ID: 971182017_971182019

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 971182017 971182019
Species Human (GRCh38) Human (GRCh38)
Location 4:24337546-24337568 4:24337565-24337587
Sequence CCCTACTGAGCGTGGGGAGATGA ATGATGTCTGACCAGTCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 96} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!