ID: 971189765_971189772

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 971189765 971189772
Species Human (GRCh38) Human (GRCh38)
Location 4:24416364-24416386 4:24416397-24416419
Sequence CCTGTGCAAAATGAATTTGCCAG GAGGCACGGGACCATGTGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!