ID: 971207349_971207358

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 971207349 971207358
Species Human (GRCh38) Human (GRCh38)
Location 4:24583881-24583903 4:24583902-24583924
Sequence CCTCCCCACGGCCCCTCTGGCTG TGGGAAGTGCCTGCTGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 431} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!