ID: 971219189_971219200

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 971219189 971219200
Species Human (GRCh38) Human (GRCh38)
Location 4:24689490-24689512 4:24689516-24689538
Sequence CCACCATCCCTCCACTCCCACTG GATTGGTGAGGAAGGAAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 11, 3: 180, 4: 1701}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!