ID: 971254527_971254539

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 971254527 971254539
Species Human (GRCh38) Human (GRCh38)
Location 4:25002169-25002191 4:25002222-25002244
Sequence CCTACTGATCAGCCTGAGATCCC ACGTGGCCCCATGTGGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 170} {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!