ID: 971263640_971263645

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 971263640 971263645
Species Human (GRCh38) Human (GRCh38)
Location 4:25078736-25078758 4:25078787-25078809
Sequence CCTGGTGTATTAGTCTGTTTTCA GGGCAATTTACAAAAGAAAGAGG
Strand - +
Off-target summary {0: 19, 1: 127, 2: 497, 3: 1003, 4: 1388} {0: 1592, 1: 1792, 2: 1635, 3: 5247, 4: 9684}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!