ID: 971290981_971290985

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 971290981 971290985
Species Human (GRCh38) Human (GRCh38)
Location 4:25339231-25339253 4:25339256-25339278
Sequence CCACATTCTGAAGTACTGGTGAT GGGCTTCAACATAAGGATTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 66, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!