|
Left Crispr |
Right Crispr |
Crispr ID |
971290981 |
971290988 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:25339231-25339253
|
4:25339259-25339281
|
Sequence |
CCACATTCTGAAGTACTGGTGAT |
CTTCAACATAAGGATTTTGGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 1, 2: 12, 3: 66, 4: 280} |
{0: 1, 1: 36, 2: 359, 3: 1426, 4: 3142} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|