ID: 971291094_971291099

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 971291094 971291099
Species Human (GRCh38) Human (GRCh38)
Location 4:25340363-25340385 4:25340401-25340423
Sequence CCCTATGCCACTCTTACACAGTC GTATGGTAAATTTTGAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161} {0: 1, 1: 0, 2: 3, 3: 45, 4: 515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!