ID: 971327458_971327468

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 971327458 971327468
Species Human (GRCh38) Human (GRCh38)
Location 4:25655862-25655884 4:25655893-25655915
Sequence CCAGCCCAGCACCTGCGGAGGGA GAGTACCGCCGCCGGGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 242, 4: 820} {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!