ID: 971387447_971387452

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 971387447 971387452
Species Human (GRCh38) Human (GRCh38)
Location 4:26154284-26154306 4:26154319-26154341
Sequence CCATCTGTAAAACAGGATAAATA TTACCTCACTGGGTAATTCAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 12, 3: 121, 4: 852} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!