ID: 971406495_971406501

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 971406495 971406501
Species Human (GRCh38) Human (GRCh38)
Location 4:26325389-26325411 4:26325407-26325429
Sequence CCCCTAGCAGCGTTCATTAAGAG AAGAGAGGCAACAGAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 28} {0: 1, 1: 0, 2: 7, 3: 48, 4: 505}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!