ID: 971457360_971457369

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 971457360 971457369
Species Human (GRCh38) Human (GRCh38)
Location 4:26857655-26857677 4:26857687-26857709
Sequence CCTGGGGGAAGCCGGCAGGAGGC GCGCGGGGCTGCGGTGGCGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 75, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!