ID: 971457916_971457920

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 971457916 971457920
Species Human (GRCh38) Human (GRCh38)
Location 4:26861244-26861266 4:26861271-26861293
Sequence CCGGAGCGGCGGACGGATGCGAG TGCCCCGGCACCTCCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29} {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!